plants
Article
Mutations Found in the Asc1 Gene That Confer Susceptibility
to the AAL-Toxin in Ancestral Tomatoes from Peru and Mexico
Rin Tsuzuki 1, Rosa María Cabrera Pintado 2 , Jorge Andrés Biondi Thorndike 2 , Dina Lida Gutiérrez Reynoso 2,
Carlos Alberto Amasifuen Guerra 2 , Juan Carlos Guerrero Abad 2 , Liliana Maria Aragón Caballero 3,
Medali Heidi Huarhua Zaquinaula 3, Cledy Ureta Sierra 3, Olenka Ines Alberca Cruz 3,
Milca Gianira Elespuru Suna 2 , Raúl Humberto Blas Sevillano 4, Ines Carolina Torres Arias 4, Joel Flores Ticona 4,
Fátima Cáceres de Baldárrago 5, Enrique Rodoríguez Pérez 6, Takuo Hozum 7, Hiroki Saito 8, Shunsuke Kotera 8,
Yasunori Akagi 9, Motoichiro Kodama 10, Ken Komatsu 8 and Tsutomu Arie 1,8,*
1 Bio-Applications and Systems Engineering—BASE, Tokyo University of Agriculture and Technology (TUAT),
Fuchu, Tokyo 183-8509, Japan; tsuzukirin@gmail.com
2 National Institute of Agricultural Innovation (INIA), La Monila 15026, Lima 12, Peru;
rcabrera@inia.gob.pe (R.M.C.P.); jbiondith@gmail.com (J.A.B.T.); dgutierrez@inia.gob.pe (D.L.G.R.);
camasifuen@inia.gob.pe (C.A.A.G.); jguerreroa@inia.gob.pe (J.C.G.A.); sdb@inia.gob.pe (M.G.E.S.)


 3
 Plant Pathology Clinic, La Molina National Agrarian University (UNALM), La Monila 15026, Lima 12, Peru;

 lili@lamolina.edu.pe (L.M.A.C.); medalihuarhua@lamolina.edu.pe (M.H.H.Z.);
Citation: Tsuzuki, R.; Cabrera 20121469@lamolina.edu.pe (C.U.S.); 20170072@lamolina.edu.pe (O.I.A.C.)
4
Pintado, R.M.; Biondi Thorndike, J.A.; Crop Husbandry Department, La Molina National Agrarian University (UNALM), La Monila 15026, Lima 12, Peru;
rblas@lamolina.edu.pe (R.H.B.S.); 20180830@lamolina.edu.pe (I.C.T.A.); joelflores@lamolina.edu.pe (J.F.T.)
Gutiérrez Reynoso, D.L.; Amasifuen 5 Department of Biology, Faculty of Biological Sciences, National University of San Augustín, Santa Catalina,
Guerra, C.A.; Guerrero Abad, J.C.;
Arequipa 04000, Peru; fatimafloriemay.silva@gmail.com
Aragón Caballero, L.M.; Huarhua 6 Department of Plan Breeding, Chapingo Autonomous University, Texcoco, CP 56230, Mexico;
Zaquinaula, M.H.; Ureta Sierra, C.; erodriguezx@yahoo.com.mx
Alberca Cruz, O.I.; Elespuru Suna, 7 Interdisciplinary Research Center for Environment and Rural Service, Chapingo Autonomous University,
M.G.; Blas Sevillano, R.H.; Torres Texcoco, CP 56230, Mexico; taqhoz@hotmail.com
Arias, I.C.; Flores Ticona, J.; de 8 Graduate School of Agriculture, Tokyo University of Agriculture and Technology (TUAT), Fuchu,
Baldárrago, F.C.; Pérez, E.R.; Tokyo 183-8509, Japan; s180960s@st.go.tuat.ac.jp (H.S.); s197882x@st.go.tuat.ac.jp (S.K.);
Hozumi, T.; Saito, H.; Kotera, S.; akomatsu@cc.tuat.ac.jp (K.K.)
9 Tottori BioFrontier, Yonago, Tottori 683-8503, Japan; royaltouch242@gmail.com
Akagi, Y.; Kodama, M.; Komatsu, K.; 10 Department of Agriculture, Tottori University, Tottori 680-8553, Japan; mk@muses.tottori-u.ac.jp
Arie, T. Mutations Found in the Asc1
* Correspondence: arie@cc.tuat.ac.jp; Tel.: +81-42-367-5691
Gene That Confer Susceptibility to
the AAL-Toxin in Ancestral Tomatoes
Abstract: Tomato susceptibility/resistance to stem canker disease caused by Alternaria alternata f.
from Peru and Mexico. Plants 2021,
10, 47. https://doi.org/10.3390/ sp. lycopersici and its pathogenic factor AAL-toxin is determined by the presence of the Asc1 gene.
plants10010047 Several cultivars of commercial tomato (Solanum lycopersicum var. lycopersicum, SLL) are reported to
have a mutation in Asc1, resulting in their susceptibility to AAL-toxin. We evaluated 119 ancestral
Received: 16 November 2020 tomato accessions including S. pimpinellifolium (SP), S. lycopersicum var. cerasiforme (SLC) and S.
Accepted: 18 December 2020 lycopersicum var. lycopersicum “jitomate criollo” (SLJ) for AAL-toxin susceptibility. Three accessions,
Published: 28 December 2020 SP PER018805, SLC PER018894, and SLJ M5-3, were susceptible to AAL-toxin. SLC PER018894
and SLJ M5-3 had a two-nucleotide deletion (nt 854_855del) in Asc1 identical to that found in SLL
Publisher’s Note: MDPI stays neu- cv. Aichi-first. Another mutation (nt 931_932insT) that may confer AAL-toxin susceptibility was
tral with regard to jurisdictional claims identified in SP PER018805. In the phylogenetic tree based on the 18 COSII sequences, a clade (S3) is
in published maps and institutional
composed of SP, including the AAL-toxin susceptible PER018805, and SLC. AAL-toxin susceptible
affiliations.
SLC PER018894 and SLJ M5-3 were in Clade S2 with SLL cultivars. As SLC is thought to be the
ancestor of SLL, and SLJ is an intermediate tomato between SLC and SLL, Asc1s with/without the
mutation seem to have been inherited throughout the history of tomato domestication and breeding.
Copyright: © 2020 by the authors. Li-
censee MDPI, Basel, Switzerland. This Keywords: Solanum pimpinellifolium; Solanum lycopersicum var. cerasiforme; alternaria alternata tomato
article is an open access article distributed pathotype; AAL-toxin; Peru
under the terms and conditions of the
Creative Commons Attribution (CC BY)
license (https://creativecommons.org/
licenses/by/4.0/).
Plants 2021, 10, 47. https://doi.org/10.3390/plants10010047 https://www.mdpi.com/journal/plants
Plants 2021, 10, 47 2 of 22
1. Introduction
Agricultural plant evolution has been driven by a complex process involving hu-
man activities and natural environment. Humans have selected individual wild plants
displaying preferable traits, for example suitable for eating, resulting in domestication
of plants [1]. Modern plant breeding has enhanced the selection of genes determining
favorable phenotypes within a diverse gene pool, which has led to a reduction in genetic
diversity among agricultural plants.
Tomato (Solanum lycopersicum L., formerly Lycopersicon esculentum Mill; SLL) is the most
abundantly produced vegetable in the world. The total production of tomatoes was ca. 0.2
billion tons from ca. 5 million ha of fields in 2019 [2]. SLL originated from S. pimpinellifolium
L. (SP) in the Andean region of South America, now occupied by Peru, Chile, Ecuador, and
Bolivia [3–6]. The history of tomato domestication began about 2000 years ago, possibly
in Mexico; subsequently, tomato was brought to Europe around 500 years ago [6–8]. The
Andes region continues to sustain wild tomato species, including not only SP but S. chilense
(Dunal) Reiche, S. chmielewskii Rick, S. habrochaites Knapp et Spooner, S. neorickii Spooner
et al., S. pennellii Correll, and S. peruvianum L. [3–6]. S. lycopersicum var. cerasiforme (Dunal)
A.Gray (SLC), an apparent intermediate hybrid between SP and SLL, is currently found as a
native-grown tomato in Mexico and several Central and South American countries, such as
Peru, Chile, Ecuador, Bolivia, and Columbia [5,9,10]. Traditional SLL cultivars, considered
to be the archetype of modern SLL cultivars, have been handed down by generations
of peasants in mountain villages in Mexico and designated “jitomate criollo” in Spanish
(SLJ) [5,9]. SLC and SLJ are sometimes collectively called transition tomatoes [5].
Solanum fruits have diverse colors. Species with orange and red fruit are in the Lycop-
ersicon species group [11] and include SP, SLC, SLL, S. cheesmaniae (SC) and S. galapagense
(SG), the latter two of which are found in the Galápagos Islands, Ecuador. A previous study
proposed that the Lycopersicon species group originated from red-fruited SP; initially SP
was domesticated in South America to give rise to SLC, and SLC later gave rise to SLL in
Mesoamerica through subsequent selection and breeding [4,10].
A phylogenetic study reported that Peruvian SP and/or SLC were transported by the
Humboldt Current or the Peru Current to the Galápagos Islands where they settled and
established SC and SG [11]. Interestingly, there are collection reports of finding SLC in the
Hawaii Islands, the Philippines, and Malaysia [12] suggesting that tomato seeds can be
carried long distances by ocean currents.
Alternaria stem canker disease caused by the ascomycete fungus Alternaria alternata
forma specialis (f. sp.) lycopersici (or, A. alternata tomato pathotype; Aal) is an important
disease in tomatoes. In 1975, the disease was reported for the first time in the SLL cultivar
(cv.) Earlypak 7 in California, USA [13], followed by a 1977 report of the pathogen infecting
cv. Aichi-first in Japan [14]. Most of the other SLL cultivars are resistant to the disease [13,15].
Purified AAL-toxin produced by Aal, a host-specific toxin, is toxic only to those cultivars
susceptible to Aal and causes necrotic lesions but not in the cultivars resistant to Aal [16].
Among wild tomatoes, SC and SG from the Galápagos Islands are known to be susceptible
to the AAL-toxin [17].
AAL-toxin is the leading cause of symptom development in stem canker disease [18].
AAL-toxin induces apoptotic cell death in SLL tissues; however, cultivars resistant to
AAL-toxin produce ceramide that protects the tissues from cell death [18]. The Asc1
(alternaria stem canker resistance protein 1) gene encodes an enzyme involved in ceramide
biosynthesis in SLL [18]. The SLL cv. Aichi-first, which is susceptible to AAL-toxin, has a
two-nucleotide deletion in the Asc1 ORF, and SC and SG have ca. a 400 nucleotide-deletion
that includes the 5′-UTR and a part of the 5′ ORF of Asc1 [17].
We hypothesized that the mutations found in Asc1 in the AAL-toxin susceptible
cultivars and SC and SG originated from the gene pool of Asc1 in SP and SLC, the possible
wild ancestors of SC and SG, and that we could find variations of Asc1 mutations in SP and
SLC. To test this hypothesis, we established a collection of SP in Peru and Ecuador; SLC in
Peru, Ecuador and Mexico; and SLJ, the archetypes of SLL, in Mexico. We investigated their
Plants 2021, 10, 47 3 of 22
susceptibilities to AAL-toxin and determined the nucleotide sequences of the respective
Asc1 genes.
2. Results
2.1. UNALM-TUAT Collection of Peruvian Tomatoes
From 2016 to 2019, we collected wild tomatoes throughout several field trips in Peru
and created the UNALM-TUAT Collection of Peruvian tomatoes composed of 41 SLC and
19 SP accessions (Table 1). In order to construct a diverse collection of wild tomatoes, we
collected throughout a large area of Peru that encompassed the northwestern coast area
including Tumbes, Piura, Lambayeque and La Libertad Regions, the northern highland and
semi-jungle area, including the Cajamarca and Huánuco Regions, the Amazon rainforest
area including the Ucayali Region, the south-central highland area including the Junin,
Cusco and Ayacucho Regions, and the Pacific coastal area including the Lima and Ica
Regions. Usually SP and SLC are found in coastal areas that are not over 800 m in elevation,
but we also found SP and SLC in valleys in the Andean Mountains like Quillabamba City in
the Cusco Region. SP and SLC were not distributed in the untouched natural environments
but rather in fallow agriculture fields and near inhabited centers. Figure 1 schematically
presents the sampling areas for SLC (squares) and SP (circles) in the UNALM-TUAT and
INIA Collections used in this study.
2.2. Accessions Susceptible to AAL-Toxin
In bioassays using leaflets, one (M5-3 sampled in Querétaro, Mexico) among the
two SLJ accessions, one (PER018894 from Huanuco, Peru) among the 62 SLC accessions,
and one (PER018805 from Lambayeque, Peru) among the 51 SP accessions presented
veinal necrosis and were determined to be susceptible to AAL-toxin (Table 1 and Figure 2).
Other accessions presented no symptoms (Table 1 and Figure S2), suggesting that they are
resistant to AAL-toxin. The references, SC (LA 0437 and 0521), SG (LA 0438 and 0528) and
SLL cv. Aichi-first were susceptible to AAL-toxin, and SLL cv. Momotaro-8 was resistant to
AAL-toxin.
Plants 2021, 10, 47 4 of 22
Table 1. Tomato accessions and cultivars used in this study, their susceptibility to AAL-toxin and mutations found in Asc1.
Mutations in Asc1 in Comparison to the Reference Sequence
b
Species and Sampling Site AAL-Toxin Gen Bank #AF198177
Accessions Susceptibility Accession
No. ca. 400 Frameshift Missense Silent Mutationc
Country Region Longitude Latitude Date a bp-Deletion Mutation Mutation Exon Intron
TUAT Collection (Inami et al.2014)
S. lycopersicum var. lycopersicum “jitomate criollo” (SLJ)
* M5-3 Mexico Queretaro N21◦16′00” W99◦24′20” 20100530 Susceptible LC596579 No deletion 854_855del 911G>A 1065G>A,1306T>G
M5-4 Mexico Queretaro N21◦16′00” W99◦24′20” 20100530 Resistant LC596581 No deletion 911G>A 1065G>A,1306T>G
S. lycopersicum var. cerasiforme (SLC)
M-UX Mexico Yucatan N20◦24′35” W89◦45′04” 20051229 Resistant LC596506 No deletion
E0040W Ecuador Santa Cruz S00◦39′06” W90◦24′21” 20080113 Resistant LC596555 No deletion 911G>A,1010A>C 1306T>G
E0043 Ecuador Santa Cruz S00◦41′45” W90◦19′36” 20080113 Resistant LC596554 No deletion 911G>A,1010A>C 1306T>G
MC-5a Mexico Hidalgo N21◦00′08” W98◦32′18” 20100528 Resistant LC596505 No deletion
MC-5b Mexico Hidalgo N21◦00′08” W98◦32′18” 20100528 Resistant LC596504 No deletion
* ML-1 Mexico Hidalgo N21◦01′06” W98◦31′46” 20100529 Resistant LC596503 No deletion
S. pimpinellifoloum (SP)
* ECU0043 Ecuador Santa Cruz S00◦41′23” W90◦19′10” 20080113 Resistant LC596553 No deletion 911G>A,1010A>C 1306T>G
ECU0045 Ecuador Santa Cruz S00◦40′05” W90◦16′08” 20080113 Resistant LC596552 No deletion 911G>A,1010A>C 1306T>G
UNALM-TUAT Collection
S. lycopersicum var. cerasiforme (SLC)
* BRC016 Peru Lima S12◦08′21” W77◦01′35” 20161104 Resistant LC596570 No deletion 911G>A 1306T>G
CCY138 Peru Lambayeque S06◦44′06” W79◦32′46” 20170130 Resistant LC596583 No deletion 911G>A, 649G>A,1366T>C 1306T>G
509A>G, 727_728insT,
* CCY152 Peru Lambayeque S06◦30′07” W79◦52′14” 20170131 Resistant LC596577 No deletion 569A>C, 748G>A,570G>A, 823G>A 1048T>A,
911G>A 1306T>G
Plants 2021, 10, 47 5 of 22
Table 1. Cont.
Mutations in Asc1 in Comparison to the Reference Sequence
Species and Sampling Site
b
AAL-Toxin Gen Bank #AF198177
Accessions Susceptibility Accession
No. ca. 400 Frameshift Missense Silent Mutationc
Country Region Longitude Latitude Date a bp-Deletion Mutation Mutation Exon Intron
1048T>A,
CCY154 Peru Lambayeque S06◦30′07” W79◦52′14” 20170131 Resistant LC596578 No deletion 1065G>A,
1306T>G
CCY156 Peru Lambayeque S06◦30′05” W79◦52′13” 20170131 Resistant LC596510 No deletion 1306T>G
CCY159 Peru Lambayeque S06◦12′03” W79◦41′56” 20170131 Resistant LC596556 No deletion 911G>A 1306T>G,1599C>T
CCY162 Peru Lambayeque S06◦12′01” W79◦41′55” 20170131 Resistant LC596511 No deletion 1306T>G
CGA028 Peru Lima S12◦01′35” W76◦41′22” 20161108 Resistant LC596512 No deletion 1306T>G
728delT,
ICA034 Peru Ica S13◦59′24” W75◦44′31” 20190204 Resistant LC596564 No deletion 1306T>G,
1843A>C
IND096 Peru Lima S12◦04′38” W76◦57′00” 20161221 Resistant LC596529 No deletion 728delT,1306T>G
IND103 Peru Lima S12◦04′42” W76◦57′01” 20161221 Resistant LC596531 No deletion 728delT,1306T>G
IND106 Peru Lima S12◦04′45” W76◦57′04” 20161221 Resistant LC596532 No deletion 728delT,1306T>G
* JAE035 Peru Cajamarca S05◦33′13” W78◦50′52” 20190209 Resistant LC596507 No deletion 911G>A 516G>A 727_728insT,1306T>G
JAE036 Peru Cajamarca S05◦33′15” W78◦51′02” 20190209 Resistant LC596508 No deletion 911G>A 516G>A 727_728insT,1306T>G
* JAE037 Peru Cajamarca S05◦39′26” W78◦41′28” 20190209 Resistant LC596509 No deletion 911G>A 516G>A 727_728insT,1306T>G
MTP033 Peru Lambayeque S06◦11′49” W79◦44′28” 20190126 Resistant LC596558 No deletion 1306T>G,1599C>T
PIU029 Peru Piura S05◦02′33” W80◦34′31” 20190121 Resistant LC596584 No deletion 1693T>G 1784T>G 1306T>G
PIU168 Peru Piura S05◦10′41” W80◦37′00” 20170201 Resistant LC596522 No deletion 911G>A 1306T>G
PIU172 Peru Piura S05◦10′40” W80◦37′02” 20170201 Resistant LC596557 No deletion 911G>A 1306T>G,1599C>T
PIU174 Peru Piura S05◦10′39” W80◦37′02” 20170201 Resistant LC596523 No deletion 911G>A 1306T>G
PKC040 Peru Lima S12◦10′54” W76◦51′26” 20161119 Resistant LC596559 No deletion 1306T>G,1599C>T
QBB204 Peru Cusco S12◦54′22” W72◦39′58” 20170226 Resistant LC596513 No deletion 1306T>G
Plants 2021, 10, 47 6 of 22
Table 1. Cont.
Mutations in Asc1 in Comparison to the Reference Sequence
Species and Sampling Site
b
AAL-Toxin Gen Bank #AF198177
Accessions Susceptibility Accession
No. ca. 400 Frameshift Missense Silent Mutationc
Country Region Longitude Latitude Date a bp-Deletion Mutation Mutation Exon Intron
QBB215 Peru Cusco S12◦51′05” W72◦42′02” 20170226 Resistant LC596514 No deletion 1306T>G
QBB223 Peru Cusco S12◦50′46” W72◦42′32” 20170226 Resistant LC596515 No deletion 1306T>G
QBB238 Peru Cusco S12◦50′05” W72◦41′58” 20170226 Resistant LC596516 No deletion 1306T>G
SMO068 Peru Lima S11◦49′14” W76◦21′24” 20161209 Resistant LC596524 No deletion 911G>A 1306T>G
769A>T,
* STP088 Peru Junin S11◦01′21” W74◦58′20” 20161218 Resistant LC596574 No deletion 911G>A 862G>A 771A>T,
1306T>G
STP089 Peru Junin S11◦01′21” W74◦58′21” 20161218 Resistant LC596582 No deletion 807T>C, 1057_1058insC,911G>A 1306T>G
STP090 Peru Junin S11◦01′22” W74◦58′20” 20161218 Resistant LC596525 No deletion 911G>A 1306T>G
STP091 Peru Junin S11◦01′21” W74◦58′21” 20161218 Resistant LC596526 No deletion 911G>A 1306T>G
STP092 Peru Junin S11◦01′21” W74◦58′21” 20161218 Resistant LC596527 No deletion 911G>A 1306T>G
TUM001 Peru Tumbes S03◦31′51” W80◦13′46” 20181216 Resistant LC596530 No deletion 728delT,1306T>G
TUM004 Peru Tumbes S03◦31′51” W80◦13′24” 20181216 Resistant LC596517 No deletion 1306T>G
TUM007 Peru Tumbes S03◦31′39” W80◦13′36” 20181216 Resistant LC596533 No deletion 728delT,1306T>G
TUM011 Peru Tumbes S03◦31′40” W80◦13′46” 20181216 Resistant LC596534 No deletion 728delT,1306T>G
TUM012 Peru Tumbes S03◦31′25” W80◦13′27” 20181216 Resistant LC596535 No deletion 728delT,1306T>G
TUM015 Peru Tumbes S03◦32′10” W80◦13′05” 20181216 Resistant LC596536 No deletion 728delT,1306T>G
TUM016 Peru Tumbes S03◦32′06” W80◦13′07” 20181216 Resistant LC596573 No deletion 727_728del,1306T>G
TUM017 Peru Tumbes S03◦32′28” W80◦13′02” 20181216 Resistant LC596537 No deletion 728delT,1306T>G
TUM021 Peru Tumbes S03◦32′27” W80◦12′44” 20181216 Resistant LC596538 No deletion 728delT,1306T>G
TUM023 Peru Tumbes S03◦32′37” W80◦12′29” 20181216 Resistant LC596539 No deletion 728delT,1306T>G
Plants 2021, 10, 47 7 of 22
Table 1. Cont.
Mutations in Asc1 in Comparison to the Reference Sequence
Species and Sampling Site
b
AAL-Toxin Gen Bank #AF198177
Accessions Susceptibility Accession
No. ca. 400 Frameshift Missense Silent Mutationc
Country Region Longitude Latitude Date a bp-Deletion Mutation Mutation Exon Intron
S. pimpinellifoloum (SP)
CCY142 Peru Lambayeque S06◦44′08” W79◦32′30” 20170130 Resistant LC596560 No deletion 617G>A 1306T>G,1599C>T
CCY164 Peru Lambayeque S06◦12′02” W79◦41′53” 20170131 Resistant LC596561 No deletion 1306T>G,1599C>T
CGA022 Peru Lima S12◦01′28” W76◦40′17” 20161108 Resistant LC596518 No deletion 1306T>G
CGA026 Peru Lima S12◦01′35” W76◦40′10” 20161108 Resistant LC596519 No deletion 1306T>G
CGA034 Peru Lima S12◦04′49” W76◦46′10” 20161108 Resistant LC596540 No deletion 728delT,1306T>G
* CPN032 Peru La Libertad S07◦07′14” W79◦28′06” 20190125 Resistant LC596528 No deletion 911G>A 1306T>G
PIU030 Peru Piura S04◦50′08” W80◦30′35” 20190122 Resistant LC596562 No deletion 1306T>G,1599C>T
PIU031 Peru Piura S05◦07′09” W80◦11′57” 20190124 Resistant LC596563 No deletion 1306T>G,1599C>T
TUM002 Peru Tumbes S03◦32′12” W80◦13′30” 20181216 Resistant LC596541 No deletion 728delT,1306T>G
TUM003 Peru Tumbes S03◦32′12” W80◦13′28” 20181216 Resistant LC596542 No deletion 728delT,1306T>G
TUM005 Peru Tumbes S03◦31′44” W80◦13′32” 20181216 Resistant LC596543 No deletion 728delT,1306T>G
TUM006 Peru Tumbes S03◦31′39” W80◦13′37” 20181216 Resistant LC596544 No deletion 728delT,1306T>G
TUM014 Peru Tumbes S03◦32′07” W80◦13′05” 20181216 Resistant LC596545 No deletion 728delT,1306T>G
TUM018 Peru Tumbes S03◦32′25” W80◦12′44” 20181216 Resistant LC596546 No deletion 728delT,1306T>G
TUM019 Peru Tumbes S03◦32′26” W80◦12′43” 20181216 Resistant LC596547 No deletion 728delT,1306T>G
TUM020 Peru Tumbes S03◦32′27” W80◦12′43” 20181216 Resistant LC596548 No deletion 728delT,1306T>G
TUM022 Peru Tumbes S03◦32′36” W80◦12′30” 20181216 Resistant LC596549 No deletion 728delT,1306T>G
Plants 2021, 10, 47 8 of 22
Table 1. Cont.
Mutations in Asc1 in Comparison to the Reference Sequence
b
Species and Sampling Site AAL-Toxin Gen Bank #AF198177
Accessions Susceptibility Accession
No. ca. 400 Frameshift Missense Silent Mutationc
Country Region Longitude Latitude Date a bp-Deletion Mutation Mutation Exon Intron
TUM024 Peru Tumbes S03◦33′11” W80◦12′24” 20181216 Resistant LC596550 No deletion 728delT,1306T>G
TUM025 Peru Tumbes S03◦33′11” W80◦12′25” 20181216 Resistant LC596551 No deletion 728delT,1306T>G
INIA
collection
S. lycopersicum var. cerasiforme (SLC)
PER018795 Peru Lima S11◦41′69” W76◦52′11” 20150819 Resistant NT NT NT NT NT NT
PER018836 Peru Cajamarca S06◦19′12” W78◦41′90” 20111013 Resistant NT NT NT NT NT NT
PER018878 Peru Cusco S12◦43′41” W72◦32′44” 20111025 Resistant NT NT NT NT NT NT
PER018879 Peru Cusco S12◦41′31” W72◦31′07” 20111025 Resistant NT NT NT NT NT NT
* PER018894 Peru Huanuco S09◦50′08” W76◦07′05” 20111109 Susceptible LC596580 No deletion 854_855del 911G>A 1065G>A,1306T>G
PER018901 Peru Huanuco S09◦48′06” W76◦04′08” 20111110 Resistant NT NT NT NT NT NT
PER018902 Peru Huanuco S09◦10′52” W75◦57′36” 20111111 Resistant NT NT NT NT NT NT
PER018909 Peru Huanuco S09◦22′55” W75◦01′57” 20111113 Resistant NT NT NT NT NT NT
PER018923 Peru Ucayali S08◦23′30” W75◦07′41” 20111116 Resistant NT NT NT NT NT NT
PER018932 Peru Ayacucho S12◦54′24” W74◦17′05” 20111213 Resistant NT NT NT NT NT NT
PER018936 Peru Ayacucho S13◦03′49” W73◦57′27” 20111214 Resistant NT NT NT NT NT NT
PER018938 Peru Ayacucho S13◦06′28” W73◦54′36” 20111214 Resistant NT NT NT NT NT NT
S. pimpinellifoloum (SP)
PER018780 Peru Lima S11◦02′22” W77◦37′37” 20110816 Resistant NT NT NT NT NT NT
PER018781 Peru Lima S11◦02′22” W77◦37′36” 20110816 Resistant NT NT NT NT NT NT
PER018782 Peru Lima S11◦01′15” W77◦37′20” 20110816 Resistant NT NT NT NT NT NT
PER018783 Peru Lima S10◦59′37” W77◦35′55” 20110816 Resistant NT NT NT NT NT NT
PER018785 Peru Lima S10◦39′50” W77◦45′66” 20110816 Resistant NT NT NT NT NT NT
PER018786 Peru Lima S10◦39′82” W77◦41′10” 20110817 Resistant NT NT NT NT NT NT
PER018788 Peru Lima S10◦40′52” W77◦44′07” 20150817 Resistant NT NT NT NT NT NT
PER018794 Peru Lima S11◦29′46” W76◦32′77” 20150817 Resistant NT NT NT NT NT NT
PER018796 Peru Lima S11◦29′73” W77◦15′61” 20150819 Resistant NT NT NT NT NT NT
PER018797 Peru Lima S11◦29′74” W77◦15′64” 20150819 Resistant NT NT NT NT NT NT
Plants 2021, 10, 47 9 of 22
Table 1. Cont.
Mutations in Asc1 in Comparison to the Reference Sequence
Species and Sampling Site AAL-Toxin Gen Bank #AF198177
b
Accessions Susceptibility Accession
No. ca. 400 Frameshift Missense Silent Mutationc
Country Region Longitude Latitude Date a bp-Deletion Mutation Mutation Exon Intron
PER018798 Peru Lambayeque S06◦27′45” W79◦37′01” 20110914 Resistant NT NT NT NT NT NT
PER018800 Peru Lambayeque S06◦26′61” W79◦36′36” 20110914 Resistant NT NT NT NT NT NT
PER018801 Peru Lambayeque S06◦26′62” W79◦36′37” 20110914 Resistant NT NT NT NT NT NT
PER018802 Peru Lambayeque S06◦25′24” W79◦34′96” 20110914 Resistant NT NT NT NT NT NT
PER018803 Peru Lambayeque S06◦25′18” W79◦33′91” 20110914 Resistant NT NT NT NT NT NT
PER018804 Peru Lambayeque S06◦20′40” W79◦26′78” 20110914 Resistant NT NT NT NT NT NT
* PER018805 Peru Lambayeque S06◦20′38” W79◦26′22” 20110914 Susceptible LC596576 No deletion 931_932insT 911G>A 1306T>G
PER018808 Peru Lambayeque S06◦08′57” W79◦41′69” 20110915 Resistant NT NT NT NT NT NT
PER018812 Peru Lambayeque S06◦38′63” W79◦46′34” 20110916 Resistant NT NT NT NT NT NT
PER018819 Peru Lambayeque S06◦43′34” W79◦29′20” 20110916 Resistant NT NT NT NT NT NT
PER018821 Peru Lambayeque S06◦44′05” W79◦32′96” 20110916 Resistant NT NT NT NT NT NT
PER018825 Peru Lima S11◦27′86” W77◦08′14” 20111007 Resistant NT NT NT NT NT NT
PER018842 Peru Cajamarca S05◦41′45” W78◦47′78” 20111014 Resistant NT NT NT NT NT NT
PER018854 Peru Cajamarca S05◦42′62” W78◦49′46” 20111014 Resistant NT NT NT NT NT NT
PER018862 Peru Cajamarca S05◦71′16” W78◦82′40” 20111014 Resistant NT NT NT NT NT NT
PER018877 Peru Cusco S12◦43′44” W72◦32′45” 20111025 Resistant NT NT NT NT NT NT
PER018926 Peru Ucayali S08◦23′41” W75◦05′32” 20111116 Resistant NT NT NT NT NT NT
PER018937 Peru Ayacucho S13◦06′28” W73◦54′37” 20111214 Resistant NT NT NT NT NT NT
PER018940 Peru Ayacucho S13◦37′34” W74◦08′44” 20111215 Resistant NT NT NT NT NT NT
TGRC Collection used as references
S. lycopersicum var. cerasiforme (SLC)
LA 1456 Mexico Veracruz N19◦10′00” W96◦08′00” 1971 Resistant LC596520 No deletion 1306T>G
LA 1623 Mexico Campeche N20◦28′59” W90◦16′59” 19750310 Resistant LC596569 No deletion
LA 1909 Peru Cusco S12◦51′00” W72◦41′00” 197807 Resistant LC596521 No deletion 1306T>G
S. pimpinellifoloum (SP)
LA 3123 Ecuador Santa Cruz ◦ ′ ◦ ′Island S00 37 00” W90 22 59” 19910516 Resistant LC596565 No deletion 836A>T
S. cheesmaniae (SC)
LA 0437 Ecuador Isabela ◦ ′ ◦ ′ 400Island S00 57 09” W90 58 39” 19561125 Susceptible LC596568 bp-deletion
Plants 2021, 10, 47 10 of 22
Table 1. Cont.
Mutations in Asc1 in Comparison to the Reference Sequence
Species and Sampling Site
b
AAL-Toxin Gen Bank #AF198177
Accessions Susceptibility Accession
No. ca. 400 Frameshift Missense Silent Mutationc
Country Region Longitude Latitude Date a bp-Deletion Mutation Mutation Exon Intron
* LA 0521 Ecuador FrenandinaIsland S00
◦22′00” W91◦33′00” 1957 Susceptible LC596567 400bp-deletion
S. galapagense (SG)
LA 0438 Ecuador Isabela S00◦ ′Island 58 39” W91
◦01′16” 19561126 Susceptible LC596566 400bp-deletion
LA 0528 Ecuador Santa Cruz S00◦45′00” W90◦19′00” 19570809 Susceptible LC596571 400 761G>C,Island bp-deletion 1306T>G
Commercial cultivars used as reeferences
Solanum lycopersicum var. lycopersicum (SLL)
* cv. Aichi-first (Matsunaga Seed, Konan,Aichi, Japan) Susceptible LC596575 No deletion 854_855del 911G>A 1306T>G
* cv. Momotaro-8 (Takii & Co, Kyoto,Japan) Resistant LC596572 No deletion 911G>A 1306T>G
a Date, yymmdd. b Blank, identical to #AF198177; NT, not tested. c An approximately 400 bp-deletion including the 5′ UTR and a part of the 5′ ORF of Asc1 as determined by PCR; * Accessions used in the
phylogenetic analyses.
Plants 2021, 10, 47 11 of 22
Figure 1. Map of the collection sites of Peruvian tomato accessions. Squares shown within each
province represent accessions of Solanum lycopersicum var. cerasiforme (SLC) and circles represent
S. pimpinellifolium (SP) from the UNALM-TUAT Collection and the INIA Collection (Table 1). Each black
square and circle shows an AAL-toxin susceptible accession. Map from Aflo Co. [19] and modified.
Plants 2021, 10, 47 12 of 22
Figure 2. Leaflet bioassay for AAL-toxin from a culture extract of Aal As-27. The abaxial side of each tomato leaflet was
wounded and a small piece of filter paper containing either the culture extract or water was placed on the wound and
incubated in a humidified chamber (25 ◦C for 3 days). The necrosis of the leaflet was evaluated, and a susceptible reaction
or resistant reaction is indicated with an “S” or “R”, respectively, in the figure. SLL cv. Aichi-first is a representative
cultivar with susceptibility to AAL-toxin. SLL cv. Momotaro-8 is a representative cultivar with resistance to AAL-toxin.
M5-3 was susceptible to AAL-toxin among two accessions of SLJ. Among 60 accessions of SLC, one accession, PER018894,
was susceptible to AAL-toxin, and the others were resistant to AAL-toxin. The reaction of BRC016 is representative of
AAL-resistant SLC accessions. Among 37 accessions of SP one accession, PER018805, was susceptible to AAL-toxin, and the
others were resistant to AAL-toxin. CPN032 is representative of AAL-resistant SP accessions.
2.3. Absence of ca. 400-bp Deletion in Asc1 in SP, SLC and SLJ
The susceptibility to AAL-toxin in SC and SG is determined by a ca. 400-bp deletion
that includes the 5′-UTR and part of the 5′ ORF of Asc1 (Figure 3) [17]. PCR using a F10/R10
primer set reveals that all tested accessions, including the three AAL-toxin susceptible
accessions (SLJ M5-3, SLC PER018894 and SP PER018805), did not have the ca. 400-bp
deletion in the Asc1 region (Table 1 and Figure 4). The references SC (LA 0437 and LA 0521)
and SG (LA 0438 and LA 0528) had the ca. 400-bp deletion as previously reported [15].
Figure 3. Schematic structure of Asc1 from SLL in the DDBJ/EMBL/GenBank databases identified as accession #AF198177.
Asc1 is composed of 6 exons and encodes an ASC1 protein of 308 amino acids. Primers indicated by arrows are listed
in Table 2. The primer set BASC87+R12 was used to amplify a ca. 1600-bp fragment containing Asc1 for cloning and
sequencing. The primer set F10+R10 was used to detect the ca. 400-bp deletion including the 5′-UTR and part of the 5′ ORF
of Asc1. White gaps shown in exon 2 represent a two-nucleotide deletion reported in SLL cv. Aichi-first and found in SLJ
PER018894 and SLC M5-3 in this study and a nucleotide insertion found in SP PER018805, respectively. An approximately
400-bp deletion including the upstream region and part of the 5′ ORF region indicated by a gray bar has been reported in
SC and SG [17].
Plants 2021, 10, 47 13 of 22
Table 2. Asc1 primers used in this study.
Name Nucleotide Sequence (5′–3′) Position a Tm ◦C Thermal Conditions Reference
Primers to amplify the ca. 1500 bp fragment including Asc1
BASC87 GGAATTCCTGCAATTCATTTGAAACTACAAC EcoR I recognition site + nt ◦424–447 70 98 C, 2 min; 30 × (98
◦C, 10 s; 59 ◦C, 30 Brandwagt et al. (2000)
◦ ◦ ◦
R12 CAAGTAGTGCTGCCTCTACAAG nt 2017–1996 61 s; 68 C, 1 min); 68 C, 7 min; 4 C, ∞ This study
Primers to detect the ca. 400 bp-deletion in the 5′-UTR and a part of the 5′ ORF of Asc1 (Figure 1)
F10 GAAACGATCAAACGTGTT nt 178–198 56 98 ◦C, 2 min; 30 × (98 ◦C, 10 s; 56 ◦C, 30 Ago et al. (2016)
R10 CAGGTCCTGCCCAGAAATAC nt 986–967 63 s; 72 ◦C, 1 min); 72 ◦C, 7 min; 4 ◦C, ∞
a Nucleotide position relative to that of accession #AF198177.
Plants 2021, 10, 47 14 of 22
Figure 4. PCR amplification with the primer set F10+R10 (Table 2) to detect the ca. 400-bp deletion including the 5′-UTR
and part of the 5′ ORF of Asc1 (Figure 3). Only the reference accessions of SC and SG had the ca. 400 bp-deletion and none
of the tested SP, SLC, and SLJ accessions had the deletion. In this figure, only representative accessions of SP, SLC, and SLJ
are presented. Marker, 1 kb DNA Ladder (New England Biolabs, Ipswich, MA, USA).
2.4. Mutations in Asc1
We sequenced the all of the Asc1 region of the tomato accessions except for 39 of the
accessions from the INIA Collection and compared the sequences with that of the reference
AAL-resistant SLL (Acc. #AF198177) [20–23].
Asc1 sequences of SLJ M5-3 and SLC PER018894, both of which were susceptible to
AAL-toxin by the leaflet test, had the two-nucleotide deletion (nt 854_855del) in the second
exon and generated a frameshift and possibly produced a non-functional protein (Figure 5
and Table 1). This two-bp deletion was identical with that reported for SLL cv. Aichi-first,
an AAL-toxin susceptible cultivar [17].
SP PER018805, susceptible to AAL-toxin by the leaflet test, had a T-insertion (nt
931_932insT) in the second exon of Asc1, causing a frameshift that might generate a
smaller, premature asc1 protein (Figure 5 and Table 1). This mutation in the Asc1 gene
has not been reported previously. Although involvement of this mutation in AAL toxin-
susceptibility in PER018805 can be genetically confirmed by outcrossing PER018805 with
an AAL-resistant SP accession, the regulation of studies on wild tomatoes in Peru has
prevented this experiment from being conducted.
Only five Mexican SLC accessions (M-UX, MC-5a, MC-5b and ML-1 in the TUAT
Collection and LA 1623 in the TGRC Collection) had an Asc1 DNA sequence identical with
#AF198177.
We found eleven kinds of missense mutations (509A>G, 569A>C, 570G>A, 572A>G,
617G>A, 807T>C, 836A>T, 911G>A, 1010A>C, 1366T>C, 1693T>G) in the Asc1 sequence
in 31 accessions (Table 1). Many silent mutations were also detected in Asc1 nucleotide
sequences of these accessions (Table 1).
Plants 2021, 10, 47 15 of 22
Figure 5. (a) Nucleotide variations found in exon 2 of Asc1 (Figure 3). Identical nucleotides are highlighted in black in
comparison to the reference sequence of SLL #AF198177 (resistant to AAL-toxin). SLL cv. Aichi-first (susceptible), SLJ
M5-3 (susceptible) from Mexico and SLC PER018894 (susceptible) from Peru have the nt 854_855del mutation, and SP
PER018805 (susceptible) from Peru has the nt 931_932insT mutation. (b) Deduced amino acid sequences of Asc1. The amino
acid sequences were aligned using CLUSTALW [24]. Identical and similar amino acids are highlighted in black or gray,
respectively, by GeneDoc [25]. * indicates termination. In comparison to the reference sequence of SLL #AF198177 (resistant
to AAL-toxin), SLL cv. Aichi-first (susceptible), SLJ M5-3 (susceptible), SLC PER018894 (susceptible) and SP PER018805
(susceptible) produce smaller proteins that may be nonfunctional.
2.5. Phylogeny
The maximum likelihood (ML) phylogeny tree based on 18 COSII sequences is pre-
sented in Figure 6. The tree formed three clades supported by high bootstrap values,
designated in this study as S1, S2 and S3. Clade S1 is composed only of Galápagos toma-
toes, including SC and SG. Clade S2 is composed of SLL commercial cultivars, SLJ and SLC
from Mexico and Peru. Clade S3 is composed of SLC and SP from Peru and Ecuador only.
All of the tested SP accessions were in Clade S3.
The accessions SLJ M5-3 and SLC PER018894, susceptible to AAL-toxin and carrying
the identical mutation (nt 854_855del) in Asc1 as SLL cv. Aichi-first, were in Clade S2 with
SLL cv. Aichi-first. The SP accession, PER018805, susceptible to AAL-toxin and with a
mutation (nt 931_932insT) in Asc1, was placed in Clade S3.
The topology of the ML tree did not contradict that of the BI tree (Figure S3).
Plants 2021, 10, 47 16 of 22
Figure 6. A maximum likelihood (ML) tree based on 18 COSII sequences of tomato accessions estimated using Modeltest-NG
ver. 0. 1. 6 [26] and RAxML-NG v. 1.0.0 [27]. S. arcanum and S. neorickii were used as outgroups. The bootstrap values
were calculated after 1,000 bootstrap replicates. The data sets of SG (LA 0317), SC (LA 1450), SLC (LA 1673), SP LA 1581),
S. arcanum (LA 2185) and S. neorickii (LA 1326) are from [10] and are indicated with a § symbol in the tree. AAL-toxin
susceptible accessions are highlighted with a black background. SC, S. cheesmaniae; SG, S. galapagense; SLC, S. lycopersicum
var. cerasiforme; SLJ, S. lycopersicum var. lycopersicum “jitomate criollo”, SLL, S. lycopersicum var. lycopersicum (commercial
varieties); SP, S. pimpinellifolium.
3. Discussion
In this study, we evaluated 119 ancestral tomato accessions for their susceptibility
to AAL-toxin produced by Aal. Only three accessions, an SLJ from Mexico, an SLC from
Peru and an SP from Peru, were susceptible to AAL-toxin; the others were resistant. The
number of AAL-toxin susceptible accessions was less than expected. This is the first time
that AAL-toxin susceptible SLJ and SLC have been reported.
Among the three AAL-toxin susceptible accessions, SLJ M5-3 sampled from Mexico
and SLC PER018894 from Peru had a frameshift mutation (nt 854_855del) identical to
that found in SLL cv. Aichi-first, also an AAL-toxin susceptible accession. As SLC is
thought to be the oldest progenitor of present-day commercial cultivars and SLJ is an
intermediate tomato between SLC and present-day commercial SLL, both of Asc1 genes
with the frameshift mutation (nt 854_855del) and without the frameshift seemed to have
been passed down throughout the history of tomato domestication and modern breeding.
As SP and its derivative species, SC and SG, have been collected from the Galápagos
Islands and the Hawaiian Islands [11], it has been proposed that SP seeds were carried to
the islands from the South American mainland by the Humboldt Current. Interestingly,
all SC and SG accessions from the Galápagos Islands evaluated so far are AAL-toxin
susceptible and have a ca. 400-bp deletion in Asc1 [17]. We inferred that the genetic
diversity of SP, including the Asc1 gene, is rich in areas considered to be the center of
origin of this species. One of the strains having the ca. 400-bp deletion in Asc1 was carried
to Galápagos Islands by the Humboldt Current to establish SC and SG there. We also
hypothesized that the original SP strains having the ca. 400-bp deletion in Asc1 still survive
in South America, the proposed center for the origin of tomatoes. Therefore, we sequenced
Plants 2021, 10, 47 17 of 22
Asc1 from 23 SP accessions (Table 1). Contrary to our expectations, no SP accession with ca.
400-bp deletion has been found. It is possible that we have not yet identified the place of
origin of the SP that crossed the ocean to the Galápagos Islands.
Although the diversity of Asc1 among the accessions seemed not as rich as expected
(Table 1), we found that PER018805, one of the SP accessions from Lambayeque in North-
western Peru, had a frameshift mutation, nt 931_932insT, in the second exon of Asc1 (Table 1).
This mutation generates the production of a smaller (97 aa.) and possibly premature asc1
protein (Figure 5) and is reported here first.
Sequencing of Asc1 identified the frequent presence of missense mutations (509A>G,
569A>C, 570G>A, 572A>G, 617G>A, 807T>C, 836A>T, 911G>A, 1010A>C, 1366T>C,
1693T>G) that did not affect the susceptibility to AAL-toxin (Table 1).
Since the stem canker disease pathogen Aal has not been reported in South America,
susceptibility/resistance to Aal or to AAL-toxin may not be a factor in the selection of Asc1
mutations. These findings suggested that if we analyze more accessions of SP, we may find
accessions having more diverse Asc1 sequences.
Silent mutations were frequently detected in introns and exons. Especially 1306T>G in
the third intron was common in SLJ (2 among the 2 accessions sequenced), SLC (46 among
51), SP (22 among 23) and both of the SLL commercial varieties (Table 1), suggesting that
the Asc1 sequence of SLL #AF198177 used as a reference in this study was not an ideal
standard type.
From 2000 to 2019, we tried to isolate Alternaria spp. from the tissues of ancestry
tomato accessions in Chile, Ecuador, Mexico and Peru. We examined SP, SLC, SLJ, SLL,
S. chilense, S. peruvianum, S. penellii and samples of the surrounding air and soil. Although
we obtained hundreds of Alternaria spp., no isolate causing stem canker in tomato was
found (data not shown) [28]. We have studied the co-evolution of tomato and tomato wilt
pathogen, F. oxysporum f. sp. lycopersici [3,5]. Tomato and the stem canker pathogen Aal
seem also likely to be a good model system for co-evolution analysis.
The ML phylogeny tree (Figure 6) formed three clades (S1–S3). Galápagos tomatoes,
SC and SG, all of which are susceptible to AAL-toxin and have the ca. 400-bp deletion in
Asc1, were grouped together as Clade S1, in agreement with a previous report [11].
Clade S2 is composed of SLC from Mexico and Peru, SLJ from Mexico and SLL
commercial cultivars (Figure 6). Although the number of accessions tested in this study is
small, clade S2 seems to support the hypothesis that the present commercial tomato (SLL)
was established from SLC via SLJ. Our finding was consistent with the report by Raziferd
et al. (2020) [10]. Clade S2 includes AAL-susceptible SLC (PER018894), SLJ (M5-3) and SLL
cv. Aichi-first, AAL-resistant SLC (BRC016 and ML-1) and SLL cv. Momotaro-8. All three
of the AAL-susceptible accessions had the identical frameshift mutation (nt 854_855del)
in Asc1, which again suggested that Asc1 with and without the nt 854_855del frameshift
mutation have been passed down throughout the history of tomato domestication and
modern breeding from SLC to SLL. The mutation was found only in clade S2.
All of the tested SP accessions from Peru and Ecuador were grouped in Clade S3.
Clade S3 also includes SLC accessions from Peru and Ecuador. Identification of SP and SLC
in this study was based on the morphological characteristics first detailed by Darwin et al.
(2003) [9]. SP and SLC are often very similar in morphology, and there have been many
discussions on how to classify them correctly [9–11]. Our phylogeny based on the COSII
complex region again indicated that SP and SLC are genetically indistinguishable (Figure 6).
JAE036, JAE037 and CPN032 constituted a subclade (S3a) supported with a bootstrap value
of 89. The accessions LA1581, CCY152, and PER018805, all of which were collected in
Lambayeque Province in different years, constituted another subgroup (S3b) with a boot
strap value of 86 (Figures 1 and 6). Interestingly one of the accessions, PER018805 was
susceptible to AAL-toxin and had a newly identified mutation (nt 931_932insT) in Asc1.
From the phylogenetic tree, this mutation appears to have occurred independently within
this subclade.
Plants 2021, 10, 47 18 of 22
Most of the accessions in Clade S3 were collected from Cajamarca, La Libertad and
Lambayeque Regions, which are geographically close, suggesting that this northwestern
area might be the center of origin for tomatoes. Moreover, the two Peruvian SLC accessions,
BRC016 and PER018894, in Clade S2 were collected in Lima and Huanuco Provinces,
respectively, both of which are in central Peru. These results suggest that these SLCs had
already formed an evolutionary branch to SLL, and, moreover, the SLC in central Peru was
likely the germplasm brought to Mesoamerica.
4. Materials and Methods
4.1. Plant Materials
The Solanum accessions used in this study are listed in Table 1. From the TUAT
Collection (Laboratory of Plant Pathology, Tokyo University of Agriculture and Technology
(TUAT), Fuchu, Tokyo) [5], two SLJ and four SLC accessions from Mexico and two SLC
and two SP accessions from Ecuador were used. No SP or SLJ accessions were collected in
Mexico or Ecuador, respectively.
The UNALM-TUAT Collection (La Molina, Peru) of Peruvian tomatoes is composed
of 41 SLC and 19 SP accessions sampled from 2016 to 2019. Details about this collection are
described in the Results section.
From the INIA Collection (La Molina, Lima, Peru) 12 SLC and 29 SP accessions
sampled from Ayacucho, Cajamarca, Cusco, Huanuco, Lambayeque, Lima, and Ucayali
regions of Peru were used (Table 1).
SC (LA 0437 and LA 0521) and SG (LA 0438 and LA 0528), which are susceptible
to Aal and its culture extract that contains AAL-toxin, were obtained from the TGRC
Collection, C.M. Rick Tomato Genetics Resource Center (Davis, CA, USA). Three additional
SLC accessions (LA 1456, LA 1632 and LA 1909) and one SP (LA 3123) accession from the
TGRC Collection were used as references.
Cultivated tomato, SLL cvs. Momotaro-8 (Takii & Co., Kyoto, Japan) and Aichi-first
(Matsunaga Seed, Konan, Aichi, Japan) were also used as references. Momotaro-8 is a
cultivar that is resistant to Aal and to its culture extract containing the AAL-toxin. In
contrast, cv. Aichi-first is susceptible to Aal and the culture extract (Figure S1) [14].
For the accessions from the TUAT, TUAT-UNALM and TGRC Collections and the
commercial cultivars, three to five seeds were sown in sterilized soil (Nippi Engei Baido;
Nihon Hiryo Co, Chuo, Tokyo, Japan) in plastic pots (7 cm in diameter) and were grown
in a greenhouse maintained at around 28 ◦C for about three weeks. Leaflets (or folioles)
were harvested. For the accessions in the INIA Collection, leaflets were harvested from
plants grown in a greenhouse for about three weeks at INIA (La Molina. Peru) and the
INIA Donoso Agriculture Experiment Station (Huaral, Peru).
4.2. Fungal Isolate and the Preparation of Culture Extracts Containing the AAL-Toxin
Alternaria alternata f. sp. lycopersici As-27 (Aal) maintained in the Laboratory of Plant
Pathology, Tottori University, Tottori, Japan was used in this study [29,30]. The isolate is
the pathogen responsible for tomato stem canker disease and also produces AAL-toxin [22].
The isolate was maintained on V-8 juice agar medium [31] in the dark at 28 ºC and was
used to prepare culture extracts.
Culture extracts of Aal containing the AAL-toxin were prepared following a published
protocol [32] with a slight modification. Briefly, Aal was cultured in a modified Richard’s
liquid medium (1 L) at room temperature for two weeks. The mycelium was removed by
filtration using filter paper (No. 1, Toyo Roshi Kaisha, Chiyoda, Tokyo, Japan), and the
filtrate was lyophilized using a freeze-dryer (VD-500, TAITEC Co., Koshigaya, Saitama,
Japan), dissolved into 100 mL 70% (v/v) acetonitrile and used as the Aal culture extract
containing the AAL-toxin. We assessed the presence of the toxin by bioassay using cv.
Aichi-first by the same manner described in 4.3.
Plants 2021, 10, 47 19 of 22
4.3. AAL-Toxin Susceptibility Assay
The test was conducted following previously reported procedures with a slight modi-
fication [30,32,33]. Briefly, a droplet (3 µL) of the Aal culture extract was pipetted onto a
3 mm square filter paper (No. 2, Toyo Roshi Kaisha) and air dried to vaporize acetonitrile.
Three-week old tomato leaflets were detached, and the abaxial side of each leaflet was
wounded slightly by rubbing with a paper towel. A droplet (30 µL) of sterilized distilled
water was applied to the leaflet wound, and the filter paper containing the culture extract
was placed on the water droplet. Filter paper to which a droplet (3 µL) of sterile distilled
water (SDW) had been applied was used as the control. The treated leaflets were placed
in a humid square petri dish (140 × 100 × 14.5 mm, Eiken Chemical, Taito, Tokyo, Japan)
and maintained at 25 ◦C for three days. Development of veinal necrosis on the leaflet
was evaluated using SLL cv. Aichi-first (susceptible to AAL-toxin and presenting veinal
necrosis) and cv. Momotaro-8 (resistant to AAL-toxin and presenting no symptoms) as
positive and negative controls, respectively.
To conserve genetic resources, wild tomato seeds cannot be transported from Peru, and,
moreover, Aal, the stem canker pathogen that has not invaded Peru, could not be transported
into Peru; thus, we have not conducted Aal-inoculation tests using wild tomatoes.
4.4. Tomato Genomic DNA Extraction
Genomic DNA from each tomato accession was purified from leaflets by a cetyltrimethy-
lammonium bromide (CTAB) protocol [34]. Freeze-dried leaflets were powdered using
a mortar and pestle and dissolved in 700 µL of CTAB buffer (2.0% (w/v) CTAB, 0.1 M
Tris-HCl pH 8.0, 0.02 M EDTA pH 8.0, and 8.2% (w/v) NaCl in Milli-Q water) containing
0.5% (v/v) β-mercaptoethanol, and incubated at 65 ◦C for 45 min with occasional mixing by
gentle swirling. To each tube, an aliquot (700 µL) of chloroform:isoamyl alcohol=24:1 (v:v)
(CIA) was added, mixed by inversion to form an emulsion, and centrifuged at 10,000× g
for 10 min at room temperature. The aqueous phase was harvested and added to 60 µL of
10× CTAB buffer. After mixing, the samples were again extracted with CIA (700 µL), mixed
by inversion, and centrifuged in the same conditions. The aqueous phase was combined
with isopropanol (500 µL), mixed well to precipitate DNA and centrifuged for 30 min at
room temperature. After centrifugation the supernatant layer was removed carefully, and
the precipitated DNA was twice washed with 99% ethanol (500 µL). The DNA pellet was
air-dried and dissolved in 50 µL of Milli-Q water.
4.5. PCR
The reference nucleotide sequence of SLL Asc1 is archived in the GenBank database
under accession #AF198177. The SLL Asc1 gene is composed of 6 exons (nts 505–645,
791–1017, 1106–1261, 1340–1525, 1616–1800, and 1889–1920) that encode a protein com-
posed of 308 amino acids. In this report the nucleotide positions are assigned in reference
to this accession unless otherwise stated.
Primer set BASC87/R12 (Table 2 and Figure 3) was used to amplify a fragment of ca.
1600 bp encoding Asc1. The reaction mixture (10 µL) contained 40 ng of gDNA, 0.4 nmol of
each primer, 1× Buffer (Toyobo, Osaka, Japan), 0.2 nmol each dNTP (Toyobo) and 0.2 U of
KOD plus NEO polymerase (Toyobo). The thermal conditions are presented in Table 2.
To detect a specific deletion of ca. 400 bp that includes the 5′ UTR and part of the 5′
ORF of Asc1 as found in SC and SG [17], the primer set F10/R10 (Table 2 and Figure 3)
was used. The reaction mixture (10 µL) contained 40 ng of gDNA, 0.3 µM each primer,
1× Ex-Taq buffer (Takara Bio, Kusatsu, Shiga, Japan), 200 µM each dNTP, and 0.25 U of
Ex-Taq polymerase (Takara Bio).
The amplicons were separated in a 1% (w/v) agarose gel by electrophoresis using TAE
buffer and were visualized by staining with 0.5 µg/mL ethidium bromide.
Plants 2021, 10, 47 20 of 22
4.6. DNA Sequencing
Amplicons obtained with the primer set BASC87/R12 were purified using ExoSAP-IT
(Thermo Fisher Scientific, Santa Clara, CA, US), attached to a fluorescent dye by STeP
PCR [35], and sequenced with an ABI 3130xl Genetic Analyzer (Thermo Fisher Scientific)
using a BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). For each
accession three individual PCR reactions and three times sequencing for each reaction by
both directions were performed. When the sequences obtained were not identical, we
performed additional PCR/sequencing and the sequence was finalized by “majority vote”.
The obtained sequences of Asc1 were aligned with that of #AF198177 (2457 bp) as
the reference sequence using Molecular Evolutionary Genetics Analysis Version 7.0 for
Bigger Datasets MEGA7 [36] and GeneStudio.exe [37]. Deduced amino acid sequences
were obtained using EMBOSS Six pack [38].
4.7. Phylogenetic Analysis of Tomato Accessions
The phylogenetic relationships among the 14 tomato accessions (indicated with an
asterisk in Table 1) and the reference accessions were analyzed based on their conserved
orthologous set (COSII) of nuclear loci [11]. Eighteen COSII markers for each accession
were amplified by PCR using the primer sets, sequenced, and combined [11]. Details about
the primers and PCR conditions are described in Table S1. The combined sequences of
the tested accessions and the reference sequences of six Solanum spp., including SC, SG,
SLC, SP, S. arcanum, and S. neorickii in the GenBank databases (Table S2), were subjected
to phylogenetic analyses using MEGA7 and MAFFT version 7 [39] (https://mafft.cbrc.jp/
alignment/server/index.html, accessed on September 16, 2020). All gaps in the alignment
were ignored in the following analyses. The phylogenies were estimated using two methods
including maximum likelihood ML [40] and Bayesian inference (BI) [41]. The data obtained
for S. arcanum (LA 2185) and S. neorickii (LA 1326), both of which are accessions in the
TGRC Collection, were used as the outgroups [11].
ML analysis was evaluated with Modeltest-NG ver. 0. 1. 6 [26] using Akaike Infor-
mation Criterion (AIC). ML phylogeny was estimated using RAxML-NG v. 1.0.0 [27] that
allows each partition (each COSII) to have its own model and parameters. Modeltest-NG
determined the appropriate substitution model for each respective COSII region (Table S3).
To evaluate the stability of the clade on the optimal tree, a bootstrap analysis was performed
with 1000 bootstrap replicates. Each branch was statistically estimated by a bootstrap (BS)
test in ML analysis and posterior probability (PP) in BI analysis.
BI phylogenetic analysis also was performed using MrBayes version 3. 2. 7a [42].
Model parameters for DNA data were chosen according to the criteria described above.
Tree searching using MrBayes was performed for 1,000,000 generations with trees sampled
every 100 generations. A conservative burn-in period was determined, and only post burn-
in trees were saved. Finally, the posterior probabilities of each branch were calculated.
5. Conclusions
AAL toxin- susceptible SP and SLC were found in this study for the first time, and
that the nt 931_932insT mutation found in SP may confer AAL-toxin susceptibility is the
novel report.
Moreover, in Clade S2, we found two AAL-toxin susceptible accessions (SLC PER018894
and SLJ M5-3) that had the nt 854_855del mutation in Asc1. The mutation was identical to
that of cv. Aichi-first, an AAL-toxin susceptible commercial cultivar of SLL. This finding
suggested that this deletion mutation in Asc1 might have passed down throughout the
history of tomato domestication and modern breeding from SLC to SLL.
Since plant breeding is usually carried out by crossing with wild species, conserving
the rich genetic resources of wild species is an important issue. We suggest that several
wild tomato genetic resources have influenced the transition and breeding of tomatoes so
far and that rich genetic resources will continue to play an important role in the future
breeding of this globally important crop.
Plants 2021, 10, 47 21 of 22
Supplementary Materials: The following are available online at https://www.mdpi.com/2223-774
7/10/1/47/s1, Figure S1: Standardization of pathogenicity in Alternaria alternata tomato pathotype
As-27 (Aal) and leaf necrosis bioassay for AAL-toxin.; Figure S2: Leaflet bioassay of all accessions
used in this study for AAL-toxin from a culture extract of Aal.; Figure S3: Bayesian inference (BI) tree
based on 18 COSII sequences of tomato accessions estimated using MrBayes version 3. 2. 7a [42];
Table S1: COSII nucleotide primers used in this study referred from Rodriguez et al. 2009 [11];
Table S2: GenBank accession numbers of 18 COSII regions nucleotide sequence; Table S3: Model
analysis of maximum likelihood (ML) and Bayesian inference (BI).
Author Contributions: Conceptualization, M.K. and T.A.; methodology, Y.A.; software, H.S. and S.K.;
investigation, R.T., C.U.S., O.I.A.C., M.G.E.S., and I.C.T.A.; writing—original draft preparation, R.T.
and T.A.; supervision, R.M.C.P., J.A.B.T., D.L.G.R., C.A.A.G., J.C.G.A., L.M.A.C., M.H.H.Z., R.H.B.S.,
J.F.T., F.C.d.B., E.R.P., T.H. and K.K. All authors have read and agreed to the published version of the
manuscript.
Funding: This research was partly funded by a Grant-in-Aids (26304025 and 20KK0133) for Scientific
Research from the Japan Society for the Promotion of Science (JSPS) awarded to TA.
Acknowledgments: The authors express their appreciation to Inami K. (TUAT), Kashiwa T. (TUAT),
Maeda C. (TUAT), Kihara E. (Lima, Peru), Kihara T. (Lima, Peru), Ramirez R.M. (University of
Agriculture Ecuador, Guayaquil, Ecuador), Mildreck R.C.R. (UNALM), Alejandro R.M. (Federal
Rural University of Pernambuco, Pernambuco, Brazil), Juan J.C.R. (State phytosanitary service, Costa
Rica, San jose), Cinthya Z.C. (UNALM), Jossyn A.L.C. (Farmex, Lima, Peru), Mafer F.M.P. (Farmex,
Lima, Peru), and Reyna M. (INIA) for helping with the collection of ancestry tomatoes and bioassay.
Accessions in INIA Collection were examined under permission #53-2020 by MINAGRI-SERFOR,
Peruvian Government. Accessions in the TUAT Collection were imported and used under special
permission of the Minister of Agriculture, Fisheries and Forestry, Japanese Government.
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Gross, B.L.; Olsen, K.M. Genetic perspectives on crop domestication. Trends Plant Sci. 2010, 15, 529–537. [CrossRef] [PubMed]
2. FAOSTAT, Food and Agriculture Organization of the United Nations Statistical Database. 2019. Available online: http://www.
fao.org/faostat/en/#data/QC (accessed on 23 December 2020).
3. Arie, T. Phylogeny and phytopathogenicity mechanisms of soilborne Fusarium oxysporum. J. Gen. Plant Pathol. 2010, 76, 403–405.
[CrossRef]
4. Blanca, J.; Cañizares, J.; Cordero, L.; Pascual, L.; Diez, M.J.; Nuez, F. Variation revealed by SNP genotyping and morphology
provides insight into the origin of the Tomato. PLoS ONE 2012, 7, e48198. [CrossRef] [PubMed]
5. Inami, K.; Kashiwa, T.; Kawabe, M.; Onokubo-Okabe, A.; Ishikawa, N.; Pérez, E.R.; Hozumi, T.; Caballero, L.A.; de Baldarrago, F.C.;
Roco, M.J.; et al. The tomato wilt fungus Fusarium oxysporum f. sp. lycopersici shares common ancestors with nonpathogenic
F. oxysporum isolated from wild tomatoes in the Peruvian Andes. Microb. Environ. 2014, 29, 200–210. [CrossRef]
6. Peralta, I.E.; Spooner, D.M.; Knapp, S. Taxonomy of wild tomatoes and their relatives (Solanum sect. Lycopersicoides, sect.
Junglandifolia, sect. Lycopersicon; Solanaceae). Syst. Bot. Monogr. 2008, 84, 1–186.
7. Jenkins, J.A. The origin of the cultivated tomato. Econ. Bot. 1948, 2, 379–392. [CrossRef]
8. Tanksley, S.D. The genetic, developmental, and molecular bases of fruit size and shape variation in tomato. Plant Cell 2004,
16, 181–189. [CrossRef]
9. Darwin, S.C.; Knapp, S.; Peralta, I.E. Taxonomy of tomatoes in the Galápagos Islands: Native and introduced species of Solanum
section Lycopersicon (Solanaceae). Syst. Biodivers. 2003, 1, 29–53. [CrossRef]
10. Razifard, H.; Ramos, A.; Della Valle, A.L.; Bodary, C.; Goetz, E.; Manser, E.J.; Li, X.; Zhang, L.; Visa, S.; Tieman, D.; et al. Genomic
evidence for complex domestication history of the cultivated tomato in Latin America. Mol. Biol. Evol. 2020, 37, 1118–1132.
[CrossRef]
11. Rodriguez, F.; Wu, F.; Ané, C.; Tanksley, S.; Spooner, D.M. Do potatoes and tomatoes have a single evolutionary history, and what
proportion of the genome supports this history? BMC Evol. Biol. 2009, 9, 191. [CrossRef]
12. TGRC, Tomato Genetics Resource Center. 2020. Available online: https://tgrc.ucdavis.edu/index.aspx (accessed on 23 December 2020).
13. Grogan, R.G.; Kimble, K.A.; Misaghi, I. A stem canker disease of tomato caused by Alternaria alternata f. sp. lycopersici.
Phytopathology 1975, 65, 880–886. [CrossRef]
14. Tagami, Y.; Tomioka, A.; Yamamoto, T.; Katagiri, N.; Kohmoto, K.; Nishimura, S. Occurrence of stem canker of tomato caused by
a distinct pathotype of Alternaria alternata in Japan. Proc. Kansai. Pl. Prit. Soc. 1984, 26, 29–32. (In Japanese).
15. Sugahara, S.; Ito, Y.; Sakurai, Y.; Narikawa, T.; Sakata, Y. Varietal difference of the resistance to stem canker caused by Alternaria
alternata in tomato. Res. Bull. Aichi. Agric. Res. Ctr. 1989, 21, 170–175. (In Japanese).
Plants 2021, 10, 47 22 of 22
16. Tsuge, T.; Harimoto, Y.; Akimitsu, K.; Ohtani, K.; Kodama, M.; Akagi, Y.; Egusa, M.; Yamamoto, M.; Otani, H. Host-selective
toxins produced by the plant pathogenic fungus Alternaria Alternata. Fems Microbiol. Rev. 2013, 37, 44–66. [CrossRef] [PubMed]
17. Ago, A.; Akagi, Y.; Itai, A.; Arie, T.; Kodama, M. A deletion in the Asc1 gene conferring resistance to the tomato pathotype of
Alternaria alternata is involved in susceptibility of wild tomato species to the disease. (abstr in Japanese). Jpn. J. Phytopathol. 2016,
82, 49.
18. Brandwagt, B.; Mesbah, L.; Laurent, P.; Takken, F.; Kneppers, T.; John, H.; Nijkamp, J.; Hille, J. The interaction of Alternaria
alternata f. sp. lycopersici and its AAL-toxins with tomato. In Molecular Genetics of Host-Specific Toxins in Plant Disease; Kohmoto, K.,
Yoder, O.C., Eds.; Springer: Dordrecht, The Netherlands, 1997; pp. 317–330.
19. Aflo Mall. Available online: https://mall.aflo.com/ (accessed on 23 December 2020).
20. Mesbah, L.A.; Kneppers, T.J.; Takken, F.L.; Laurent, P.; Hille, J.; Nijkamp, H.J. Genetic and physical analysis of a YAC contig
spanning the fungal disease resistance locus Asc of tomato (Lycopersicon esculentum). Mol. Gen. Genet. 1999, 261, 50–57. [CrossRef]
21. Aoki, K.; Yano, K.; Suzuki, A.; Kawamura, S.; Sakurai, N.; Suda, K.; Kurabayashi, A.; Suzuki, T.; Tsugane, T.; Watanabe, M.; et al.
Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the
Solanaceae genomics. BMC Genom. 2010, 11, 210. [CrossRef]
22. Brandwagt, B.F.; Mesbah, L.A.; Takken, F.L.W.; Laurent, P.L.; Kneppers, T.J.A.; Hille, J.; Nijkamp, H.J.J. A longevity assurance
gene homolog of tomato mediates resistance to Alternaria alternata f. sp. lycopersici toxins and fumonisin B1. Proc. Natl. Acad.
Sci. USA 2000, 97, 4961–4966. [CrossRef]
23. Spassieva, S.D.; Markham, J.E.; Hille, J. The plant disease resistance gene Asc-1 prevents disruption of sphingolipid metabolism
during AAL-toxin-induced programmed cell death. Plant J. 2002, 32, 561–572. [CrossRef]
24. Multiple Sequence Alignment by CLUSTALW. Available online: https://www.genome.jp/tools-bin/clustalw (accessed on 23 December 2020).
25. Nicholas, K.B.; Nicholas, H.B., Jr. GeneDoc: A Tool for Editing and Annotating Multiple Sequence Alignments. 1997. Available online:
www.psc.edu/biomed/genedoc (accessed on 23 December 2020).
26. Darriba, D.; Posada, D.; Kozlov, A.M.; Stamatakis, A.; Morel, B.; Flouri, T. ModelTest-NG: A new and scalable tool for the selection
of DNA and protein evolutionary models. Mol. Biol. Evol. 2020, 37, 291–294. [CrossRef]
27. Kozlov, A.M.; Darriba, D.; Flouri, T.; Morel, B.; Stamatakis, A. RAxML-NG: A fast, scalable and user-friendly tool for maximum
likelihood phylogenetic inference. Bioinformatics 2019, 35, 4453–4455. [CrossRef] [PubMed]
28. Kodama, M. Evolution of pathogenicity in Alternaria plant pathogens. J. Gen. Plant Pathol. 2019, 85, 471–474. [CrossRef]
29. Akagi, Y.; Akamatsu, H.; Otani, H.; Kodama, M. Horizontal chromosome transfer, a mechanism for the evolution and differentia-
tion of a plant-pathogenic fungus. Eukaryot. Cell 2009, 8, 1732–1738. [CrossRef] [PubMed]
30. Akagi, Y.; Taga, M.; Yamamoto, M.; Tsuge, T.; Fukumasa-Nakai, Y.; Otani, H.; Kodama, M. Chromosome constitution of hybrid
strains constructed by protoplast fusion between the tomato and strawberry pathotypes of Alternaria alternata. J. Gen. Plant Pathol.
2009, 75, 101–109. [CrossRef]
31. Cassol, T.; Clair, D.A.S. Inheritance of resistance to blackmold (Alternaria alternata (Fr.) Keissler) in two interspecific crosses of
tomato (Lycopersicon esculentum × L. cheesmanii f. typicum). Appl. Genet. 1994, 88, 581–588. [CrossRef] [PubMed]
32. Akamatsu, H.; Itoh, Y.; Kodama, M.; Otani, H.; Kohmoto, K. AAL-toxin-deficient mutants of Alternaria alternata tomato pathotype
by restriction enzyme-mediated integration. Phytopathology 1997, 87, 967–972. [CrossRef] [PubMed]
33. Yamagishi, D.; Akamatsu, H.; Otani, H.; Kodama, M. Pathological evaluation of host-specific AAL-toxins and fumonisin
mycotoxins produced by Alternaria and Fusarium species. J. Gen. Plant Pathol. 2006, 72, 323–327. [CrossRef]
34. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nuc. Acids. Res. 1980, 8, 4321–4325.
[CrossRef]
35. Platt, A.R.; Woodhall, R.W.; George, A.L. Improved DNA sequencing quality and efficiency using an optimized fast cycle
sequencing protocol. Biotechniques 2007, 43, 58–62. [CrossRef]
36. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol.
2016, 33, 1870–1874. [CrossRef]
37. GeneStudio. 2011. Available online: http://genestudio.com/ (accessed on 23 December 2020).
38. Rice, P.; Longden, I.; Bleasby, A. EMBOSS: The European molecular biology open software suite. Trends. Genet. 2000, 16, 276–277.
[CrossRef]
39. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and
visualization. Brief. Bioinf. 2019, 20, 1160–1166. [CrossRef] [PubMed]
40. Felsenstein, J. Evolutionary trees from DNA sequences: A maximum likelihood approach. J. Mol. Evol. 1981, 17, 368–376.
[CrossRef] [PubMed]
41. Yang, Z.; Rannala, B. Bayesian phylogenetic inference using DNA sequences: A Markov Chain Monte Carlo Method. Mol. Biol. Evol.
1997, 14, 717–724. [CrossRef] [PubMed]
42. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [CrossRef]
[PubMed]